Review




Structured Review

Addgene inc sgrna1
Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna1/product/Addgene inc
Average 93 stars, based on 19 article reviews
sgrna1 - by Bioz Stars, 2026-03
93/100 stars

Images



Similar Products

93
Addgene inc sgrna1
Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna1/product/Addgene inc
Average 93 stars, based on 1 article reviews
sgrna1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc sgrna2
Sgrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna2/product/Addgene inc
Average 93 stars, based on 1 article reviews
sgrna2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc paper n a ggttcttcgccgctgttccct sgrna1 gggtgtgttgaagccggcgtc
Paper N A Ggttcttcgccgctgttccct Sgrna1 Gggtgtgttgaagccggcgtc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a ggttcttcgccgctgttccct sgrna1 gggtgtgttgaagccggcgtc/product/Addgene inc
Average 93 stars, based on 1 article reviews
paper n a ggttcttcgccgctgttccct sgrna1 gggtgtgttgaagccggcgtc - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc usp19 δtm
The ER-anchored <t>USP19</t> promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments
Usp19 δtm, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/usp19 δtm/product/Addgene inc
Average 93 stars, based on 1 article reviews
usp19 δtm - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc usp19 c506s
The ER-anchored <t>USP19</t> promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments
Usp19 C506s, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/usp19 c506s/product/Addgene inc
Average 93 stars, based on 1 article reviews
usp19 c506s - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc usp19 nter
The ER-anchored <t>USP19</t> promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments
Usp19 Nter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/usp19 nter/product/Addgene inc
Average 93 stars, based on 1 article reviews
usp19 nter - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc usp19 494 1318
The ER-anchored <t>USP19</t> promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments
Usp19 494 1318, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/usp19 494 1318/product/Addgene inc
Average 93 stars, based on 1 article reviews
usp19 494 1318 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc usp19 knockout
The ER-anchored <t>USP19</t> promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments
Usp19 Knockout, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/usp19 knockout/product/Addgene inc
Average 93 stars, based on 1 article reviews
usp19 knockout - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Construct, Residue, Ubiquitin Proteomics, Activity Assay, FLAG-tag, Variant Assay, Transfection, Immunofluorescence, Western Blot, Isolation, Control, Expressing, TRAP Assay, Plasmid Preparation, Negative Control, MANN-WHITNEY, Over Expression, Clinical Proteomics, Membrane, Permeability, Staining

The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Ubiquitin Proteomics, Activity Assay, Construct, Mutagenesis, Expressing, Western Blot, Control, MANN-WHITNEY, Immunoprecipitation

The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation, Staining, SDS Page, Electron Microscopy

Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Electron Microscopy, RNA Sequencing, Expressing, Negative Control, Membrane

TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Marker, Expressing, Immunofluorescence, Imaging, Staining, Construct, Software, Immunoprecipitation, FLAG-tag, Negative Control, Western Blot

Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Inhibition, Control, Expressing, Western Blot, MANN-WHITNEY

VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation

DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, Mutagenesis, MANN-WHITNEY

The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Construct, Residue, Ubiquitin Proteomics, Activity Assay, FLAG-tag, Variant Assay, Transfection, Immunofluorescence, Western Blot, Isolation, Control, Expressing, TRAP Assay, Plasmid Preparation, Negative Control, MANN-WHITNEY, Over Expression, Clinical Proteomics, Membrane, Permeability, Staining

The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Ubiquitin Proteomics, Activity Assay, Construct, Mutagenesis, Expressing, Western Blot, Control, MANN-WHITNEY, Immunoprecipitation

The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation, Staining, SDS Page, Electron Microscopy

Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Electron Microscopy, RNA Sequencing, Expressing, Negative Control, Membrane

TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Marker, Expressing, Immunofluorescence, Imaging, Staining, Construct, Software, Immunoprecipitation, FLAG-tag, Negative Control, Western Blot

Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Inhibition, Control, Expressing, Western Blot, MANN-WHITNEY

VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation

DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, Mutagenesis, MANN-WHITNEY

The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Construct, Residue, Ubiquitin Proteomics, Activity Assay, FLAG-tag, Variant Assay, Transfection, Immunofluorescence, Western Blot, Isolation, Control, Expressing, TRAP Assay, Plasmid Preparation, Negative Control, MANN-WHITNEY, Over Expression, Clinical Proteomics, Membrane, Permeability, Staining

The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Ubiquitin Proteomics, Activity Assay, Construct, Mutagenesis, Expressing, Western Blot, Control, MANN-WHITNEY, Immunoprecipitation

The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation, Staining, SDS Page, Electron Microscopy

Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Electron Microscopy, RNA Sequencing, Expressing, Negative Control, Membrane

TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Marker, Expressing, Immunofluorescence, Imaging, Staining, Construct, Software, Immunoprecipitation, FLAG-tag, Negative Control, Western Blot

Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Inhibition, Control, Expressing, Western Blot, MANN-WHITNEY

VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation

DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, Mutagenesis, MANN-WHITNEY

The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Construct, Residue, Ubiquitin Proteomics, Activity Assay, FLAG-tag, Variant Assay, Transfection, Immunofluorescence, Western Blot, Isolation, Control, Expressing, TRAP Assay, Plasmid Preparation, Negative Control, MANN-WHITNEY, Over Expression, Clinical Proteomics, Membrane, Permeability, Staining

The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Ubiquitin Proteomics, Activity Assay, Construct, Mutagenesis, Expressing, Western Blot, Control, MANN-WHITNEY, Immunoprecipitation

The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation, Staining, SDS Page, Electron Microscopy

Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Transmission Assay, Electron Microscopy, RNA Sequencing, Expressing, Negative Control, Membrane

TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Marker, Expressing, Immunofluorescence, Imaging, Staining, Construct, Software, Immunoprecipitation, FLAG-tag, Negative Control, Western Blot

Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Inhibition, Control, Expressing, Western Blot, MANN-WHITNEY

VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation

DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The mammalian expression constructs pRK-Flag-USP19 wild-type (USP19 WT , Addgene #78597), USP19 1-1290 (USP19 ΔTM , Addgene #78579), USP19 1-493 (USP19 Nter , Addgene #78581), USP19 494-1318 (USP19 Cter , Addgene #78587) and USP19 C506S (Addgene #78584) were purchased from Addgene and were previously described [ ].

Techniques: Expressing, Western Blot, Control, Mutagenesis, MANN-WHITNEY

The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of misfolded TDP-43 in the HEK293T cellular model. a Schematic representation of Flag-USP19 constructs used in this study. The C506 residue represents an essential amino acid residue necessary for the ubiquitin peptidase catalytic activity. CS 1&2 CHORD-containing proteins and STG1, UBL ubiquitin-like, USP ubiquitin-specific peptidase, TM transmembrane domain, ZnF zinc finger, ΔTM deleted for the transmembrane domain. The pink star represents the amino terminal Flag tag. b Schematic representation of the full-length TDP-43 (upper panel). The K263E variant is highlighted in blue. LCD Low Complexity Domain, NLS nuclear localization sequences, NTD N-terminal domain, RRM1&2 RNA recognition motif 1&2. HEK293T cells were transfected with TDP-43-WT or TDP-43-K263E encoding constructs and were visualized by immunofluorescence using anti-TDP-43 antibody. Blue signal corresponds to DAPI for nuclei and green signal to TDP-43. Scale bar is 10 µm. c Immunoblotting of sarkosyl soluble supernatant (Sark-sol) and sarkosyl insoluble pellet (Sark-ins) fractions isolated from control HEK293T cells (lanes 1 and 4), or cells expressing TDP-43-WT (lanes 2 and 5) or TDP-43-K263E (lanes 3 and 6) using antibodies directed against TDP-43 and GAPDH as loading control. d Evaluation of misfolded TDP-43 secretion by filter trap assay (FTA). Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing TDP-43-WT and TDP-43-K263E and the different Flag-USP19 or the empty vector (negative control) was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. e Quantification of secreted TDP-43 upon USP19 expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test ( **p < 0.001 ). f USP19-WT or USP19-ΔTM and TDP-43-K263E overexpression does not affect plasma membrane permeability and cell viability. HEK293T cells transfected with the indicated plasmids were stained with trypan blue and counted. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Construct, Residue, Ubiquitin Proteomics, Activity Assay, FLAG-tag, Variant Assay, Transfection, Immunofluorescence, Western Blot, Isolation, Control, Expressing, TRAP Assay, Plasmid Preparation, Negative Control, MANN-WHITNEY, Over Expression, Clinical Proteomics, Membrane, Permeability, Staining

The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ubiquitin peptidase activity is essential for TDP-43-K263E secretion in USP19 context. a Schematic representation of Flag-USP19 constructs. The USP19-C506S corresponds to an ER-anchored but ubiquitin peptidase catalytically inactive mutant. b Ubiquitination level in cell lysates of co-expressing cells. Immunoblotting of cell lysates from TDP-43-K263E and the indicated Flag-USP19 co-expressing cell using antibodies directed against Ubiquitin or GAPDH as loading control. c Evaluation of misfolded TDP-43 secretion by FTA. Presence of misfolded TDP-43 in conditioned media from HEK293T cells overexpressing the TDP-43-K263E, the WT, the ΔTM or the C506S Flag-USP19, was monitored by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using anti-Flag (for USP19), -TDP-43 and -GAPDH antibodies for loading control. d Quantification of secreted TDP-43-K263E upon USP19s expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (** p < 0.001). e TDP-43-K263E deubiquitination is promoted by USP19-WT. Lysates from HEK293T cells co-expressing Myc-TDP-43-K263E and HA-Ubiquitin-WT with Flag-USP19-C506S (ubiquitin peptidase deficient mutant; lane 1) or Flag-USP19-WT (lane 2) were immunoprecipitated with anti-Myc and immunoblotted with anti-HA and anti-Myc. Whole cell lysates (WCL; 5 μg/input) from co-expressing cells were immunoblotted using anti-Myc, anti-Flag and anti-GAPDH for loading control. Asterisks correspond to heavy and light chains of immunoglobulins used during the immunoprecipitation

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Ubiquitin Proteomics, Activity Assay, Construct, Mutagenesis, Expressing, Western Blot, Control, MANN-WHITNEY, Immunoprecipitation

The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: The ER-anchored USP19 promotes the secretion of free TDP-43-K263E fibrils in the conditioned medium. a Transmission of misfolded HA-TDP-43-K263E to naïve HEK293T cells. Naive HEK293T cells were cocultured with conditioned media from HEK293T co-expressing cells Flag-USP19-WT or − ΔTM with HA-TDP-43-K263E during 72 h. b After 3 days, cells were washed and analyzed by Western blotting using anti-HA and anti-GAPDH as loading control. c Quantification of n = 5 independent experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Aggregated TDP-43 levels in conditioned media from HEK293T cells overexpressing TDP-43-K263E and the Flag-USP19 WT and ΔTM were precleared to eliminate cellular debris and ultracentrifuged at 120,000 g pellet (p120K pellet) and analyzed by immunoblotting (lanes 3 and 4) using antibody directed against TDP-43. Cellular lysates (lanes 1 and 2) were analyzed by Western blotting and probed by antibodies directed against TDP-43, Flag and GAPDH (loading control). e Sucrose equilibrium density gradient fractionation of conditioned medium. The p120K pellet was fractionated through a linear sucrose equilibrium density gradient 9–60% and fractions (× 15), recovered from the top of the gradient, were analyzed by Western blotting using anti-TDP-43 or anti-CD81 and anti-CD63 antibodies for extracellular vesicles markers. Fraction density values (g/cm 3 ) are depicted at the bottom panel. Whole cell lysate (WCL) of co-expressing cells was immunoblotted in parallel using the anti-TDP-43, anti-CD63 and anti-CD81. The bottom panel corresponds to the TCE staining of the SDS-PAGE gel. f Immunogold electron microscopy (IEM) of TDP-43-K263E positive fractions. Positive fractions (10–12) containing the TDP-43-K263E were pooled and analyzed by IEM using anti-TDP-43 labelled with a secondary antibody coupled with 10 nm gold particle. Amorphous and fibrillar structures were labelled (red arrows). Scale bars are 20 and 50 nm

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Transmission Assay, Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation, Staining, SDS Page, Electron Microscopy

Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Transmission electron microscopy (TEM) and RNA sequencing analyses point out ER alterations in TDP-43-K263E and USP19-WT co-expressing cells. a Ultrastructural analyses. TEM of TDP-43-K263E + UPS19-WT (panel i); TDP-43-K263E (panel ii); TDP-43-K263E + USP19-ΔTM (panel iii) and untransfected cells (UT; panel iv as negative control). Black arrows indicate dilated endoplasmic reticulum (ER) accumulation (panels i and v; v-right corresponds to a higher magnification of panel v). White asterisk indicates cytoplasmic aggregates (panel ii). White arrows indicate compact electron dense structures (CEDS; panel iii). Red arrows indicate mitochondria in close contacts with ER (panels v-right to vii). Yellow arrowheads indicate autophagic/endosomal compartments containing ER membrane and dense amorphous structures. (panels v-right, x and xi). Scale bars are 2 and 5 μm. Dotted squares correspond to higher magnification b Volcano plot of differentially expressed genes between TDP-43-K263E/USP19-WT versus TDP-43-K263E/USP19-ΔTM co-expressing cells. Red dots represents upregulated genes (P < 0.05 and Log2FC > 1), blue dots represents downregulated genes (P < 0.05 and Log2FC < -1), and grey dots represent genes that were not differentially expressed. c Bubble plot of the GO Biological process pathway enrichment analysis. The horizontal axis represents the enrichment score (-log10(p-value)), while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and size of the bubble indicates the number of genes corresponding to each pathway

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Transmission Assay, Electron Microscopy, RNA Sequencing, Expressing, Negative Control, Membrane

TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: TDP-43-K263E colocalizes with USP19-WT and the KDEL-ER marker and coimmunoprecipitates with USP19-WT. a TDP-43 IEM of HEK293T TDP-43-K263E + Flag-WT-USP19 co-expressing cells. Red arrows indicate the TDP-43 gold particles in close contacts with dilated ER structures in the cytoplasm (panel i) or inside autophagic/endosomal compartments (panels iii and iv). Red arrowheads correspond to free TDP-43 aggregates in intracellular compartments (panel ii). White arrowheads correspond to TDP-43 labelling embedded in amorphous structures present in intracellular autophagic/endosomal compartments (panel iv). b Confocal immunofluorescence imaging of TDP-43-K263E + Flag-USP19-WT co-expressing cells. Co-expressing cells were labelled with antibodies directed against the ER KDEL marker (red), the Flag-USP19-WT (magenta), the HA for TDP-43-K263E (green) and the DAPI (blue) for nuclear staining. Scale bar is 10 μm. c ROI 1–2 are depicted in the merge panel. The plot profiles of the ER-KDEL marker (red) with the Flag-USP19-WT (magenta) and the HA-TDP-43-K263E (green) colocalizations (ROI1 and 2) along the ROI lines were constructed and analyzed using Image J software. White arrowheads show other colocalized signals d TDP-43 coimmunoprecipitates with Flag-USP19-WT. Left panel: co-immunoprecipitation experiment was realized on cell lysates from TDP-43-K263E and Flag-USP19-WT co-expressing cells using mouse antibodies directed against the Flag epitope or an irrelevant SARS-CoV2 IgG antibody as negative control. Right panel: Western blotting of HA-TDP-43-K263E and Flag-USP19-WT co-expressing cell lysates (input) using antibodies directed against Flag (for USP19), HA (for TDP-43) and GAPDH

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Marker, Expressing, Immunofluorescence, Imaging, Staining, Construct, Software, Immunoprecipitation, FLAG-tag, Negative Control, Western Blot

Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: Early autophagic and endosomal compartments are involved in the TDP-43-K263E secretion mediated by USP19-WT. a Schematic representation of cellular trafficking and inhibition strategies (pharmacological in blue and siRNAs in red) used in this study to identify potential pathways involved in the TDP-43-K263E secretion mediated by USP19. b-f Evaluation of the TDP-43-K263E secretion mediated by USP19 by FTA in presence of siRNAs control (CT) or siRNAs directed against ATG7 , RAB11A , HRS/HGS , RAB8A or RAB27A . Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from siRNAs CT/targets-treated co-expressing cells using antibodies directed against ATG7, RAB11A, HRS/HGS, RAB8, RAB27A or Flag (for USP19), TDP-43, and GAPDH for loading control. Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT and targets ATG7 , RAB11A , HRS/HGS , RAB8A and RAB27A are depicted in the right panels of each condition. Data represent mean ± SEM, n = 4 to 6 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05)

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Inhibition, Control, Expressing, Western Blot, MANN-WHITNEY

VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: VAMP7 is a modulator of the TDP-43-K263E secretion mediated by USP19-WT. a Evaluation of the TDP-43-K263E secretion mediated by EGFP-VAMP7-WT and Flag-USP19-WT by FTA. Upper panel (secretion): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7-WT) and GAPDH for loading control. b Quantification of secreted TDP-43-K263E in presence of GFP-VAMP7-WT or Flag-USP19-WT expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test, ns = not significant. c Sucrose equilibrium density gradient fractionation of conditioned medium. The 120,000xg pellet (p120K) from conditioned media of TDP-43-K263E + GFP-VAMP7-WT co-expressing cells were fractionated through a 8–60% linear sucrose equilibrium density gradient and fractions (× 15), recovered from the top were analyzed by Western blotting using anti-TDP-43 or anti-CD81 antibody. Fraction density values (g/cm 3 ) are depicted at the bottom panel. d Evaluation of TDP-43-K263E secretion mediated by USP19-WT in presence of EGFP- VAMP7-WT, EGFP-Longin-VAMP7, EGFP-YKT6-WT or EGFP-Longin-YKT6 by FTA. Upper panel (secretion/conditioned medium): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for USP19), TDP-43, GFP (for VAMP7s and YKT6s) and GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by Flag- USP19-WT in presence of VAMP7 or YKT6-WT and -Longins expression. Data represent mean ± SEM, n = 4 experiments. Significance was assessed by a Mann–Whitney U test (*p < 0.05), ns = not significant

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Expressing, Western Blot, Control, MANN-WHITNEY, Fractionation

DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Enhanced secretion of the amyotrophic lateral sclerosis ALS-associated misfolded TDP-43 mediated by the ER-ubiquitin specific peptidase USP19

doi: 10.1007/s00018-025-05589-w

Figure Lengend Snippet: DNAJC5/CSPα is a modulator of the misfolded TDP-43-K263E secretion mediated by Flag-USP19-WT. a Evaluation of TDP-43-K263E secretion mediated by 3x-Flag-CSPα-WT or the phospho-deficient CSPα-S10A by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against HA (for HA tagged TDP-43), CSPα and GAPDH for loading control. b Evaluation of the TDP-43-K263E secretion mediated by USP19-WT in presence of CSPα-WT or CSPα-S10A mutant by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells using antibodies directed against Flag (for Flag-USP19-WT), TDP-43, CSPα and GAPDH for loading control. c Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of CSPα-WT or the phosphor-deficient CSPα-S10A expression. Data represent mean ± SEM, n = 5 experiments. Significance was assessed by a Mann–Whitney U test (**p < 0.001). d Evaluation of TDP-43-K263E secretion mediated by Flag-USP19-WT in presence of siRNAs CT or siRNAs directed against CSPα by FTA. Upper panel (secretion/conditioned media): nitrocellulose membranes were probed with an antibody directed against TDP-43. Lower panel (cell expression): Western blotting of cell lysates from co-expressing cells treated with siRNAs CT or against CSPα using antibodies directed against CSPα, Flag (for Flag-USP19-WT), TDP-43, or GAPDH for loading control. e Quantification of secreted TDP-43-K263E mediated by USP19-WT in presence of siRNAs CT or siRNAs CSPα. Data represent mean ± SEM, n = 3 experiments

Article Snippet: The USP19 sgRNA1 and sgRNA2 used for USP19 knockout in HEK293T cells were provided by Yihong Ye (Addgene plasmids #78585 and #78586).

Techniques: Expressing, Western Blot, Control, Mutagenesis, MANN-WHITNEY